Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa-circ-0040809 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Hypertension | ICD-10 | Essential (primary) hypertension (I10) |
DBLink | Link to database | PMID | 28534714 |
Experimental Method | |||
Sample Type | Plasma sample | Comparison | A total of 108 participants (hypertension, n = 54; healthy controls, n = 54) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CCAAATTGCAAGCCCTGGAG ReverseTGCAATCTGAACCACATCGG | Statistics | Fold Change : Downregulated,2.3839095 pvalue : p=0.00003091252 |
Citation | |||
Wu, N, Jin, L, Cai, J (2017). Profiling and bioinformatics analyses reveal differential circular RNA expression in hypertensive patients. Clin. Exp. Hypertens., 39, 5:454-459. |